Esercitazione 1: Ricerche bibliografiche con PubMed e CAB

Consultare la pagina "Banche dati" prima di cominciare l'esercitazione. Questa pagina contiene un elenco abbastanza completo delle principali risorse bioinformatiche. Usatelo come fosse un elenco telefonico di siti, quando vi serve un indirizzo. Come già accennato nella home di questo sito, usate le schede di Firefox, tenendo aperta questa pagina....

attenzione Rispondere alle domande proposte in un file da salvare nella cartella documenti/esercitazioni, chiamandolo "es1_nome_cognome.txt". Usare un programma per creare testi che trovate nel menu Applicazioni -> Accessori -> Editor di Testo (Blocco note) . Salvate subito il file chiamandolo come già detto, e salvatelo periodicamente per non perdere le risposte in caso di blocco del computer. Mettete il numero prima di ogni risposta e non centellinate i caratteri (es: "La rivista è consultabile in rete d'ateneo", non limitatevi a rispondere "Si").

PubMed tutorial

Dal sito dei tutorial di PubMed (link) seguitene alcuni, in particolare tutti quelli sulle ricerche in PubMed (Searching PubMed) e possibilmente quelli sulle ricerche lessicali con MeSH. Questi tutorial insegnano a formulare bene le query (ricerche) in PubMed, e sono quindi importanti per proseguire bene l'esercitazione.

Ricerche bibliografiche

1) Risalire al nome completo della rivista: Ann. Entomol. Soc. Am.
1a) Inoltre verificare se è accessibile da rete
1b) In che anno è iniziata la pubblicazione (cartacea)?

2) Risalire al nome completo della rivista: PNAS
 2a) Inoltre verificare se è accessibile da rete.
 2b) Accedete alla home page della rivista. Cercate tramite il sito un articolo su un argomento di vostro interesse. Riportate nel vostro file la query effettuata ed il titolo dell'articolo che, dalla lista dei risultati, vi sembra più interessante.

3) Accedere con PubMed alla lista di pubblicazioni del Dott. Stefano Campanaro dell'Università di Padova. Nota: solo da pochi anni PubMed registra il nome proprio degli autori, quindi è preferibile cercare "Campanaro S" piuttosto che "Campanaro Stefano", altrimenti le pubblicazioni più vecchie non verrebbero mostrate. Provate nei due modi e riportate il numero di articoli che appaiono in un modo e nell'altro. 
  3a) Dalla lista degli articoli selezionatene uno di quelli accessibile liberamente e riportatene titolo e lista di autori nel vostro file.

4) Utilizzare il Sistema Bibliotecario Ateneo  (http://www.cab.unipd.it/)
 4a) Vedere se la rivista Cell è consultabile in rete d'ateneo.
 4b) Provate a vedere lo stesso anche per PNAS.

5) Ricercare un articolo in PUBMED rispettando le fasi sotto elencate:

P.S.: Durante la ricerca ricordate di utilizzare gli operatori booleani (AND, OR...) e i limiti. 

  5a) Riportate la query che avete formulato.
  5b) Quanti articoli vengono trovati? Ce ne sono di accessibili liberamente? Quanti?

6) Batteri piezofili
Adesso provate voi a cercare gli articoli su un batterio adattato alle alte pressioni (piezofilo), Photobacterium profundum.

  6a) Quanti articoli ottenete? Sono presenti articoli pubblicati sulla rivista "Science"? Quanti?
  6b) Limitate la ricerca alle sole review. Quante ne sono state pubblicate fino ad oggi? Se effettuate la ricerca con una query più di ampio respiro (ad esempio "piezophiles OR piezophilic"), quante review trovate?

 

Manipolazione sequenze nucleotidiche

Per questa parte di esercitazione utilizzeremo alcune applicazioni presenti nel sito del CRIBI-Genomics dell'Università di Padova (http://genomics.cribi.unipd.it/Main_Page).

Sequenza complementare ed inversa complementare:
Dovreste essere in grado di trasformare una sequenza nucleotidica nella sua complementare e/o inversa-complementare. Se la sequenza fosse lunga, il lavoro sarebbe un po' laborioso. Ci vengono in aiuto alcuni strumenti in rete.

Collegarsi al sito http://promix.cribi.unipd.it/cgi-bin/promix/promix_menu.pl (dove, tra le altre cose, potrete trovare particolari programmi per l'analisi termodinamica di corte sequenze di DNA). Da questo menù, selezionare 'Sequence Utility' e poi 'Rev/Comp any sequence'. Apparirà un''apposita form dove potrete scrivere una sequenza oligonucleotidica a propria scelta (per l'esercizio, è sufficiente una corta sequenza di 15-20 basi). Consiglio: prima di inviare la query e vedere il risultato, scrivere nel vostro foglio appunti, la relativa sequenza complementare ed inversa complementare, riportando correttamente le estremità 5' e 3'. Alla fine controllate se la vostra soluzione risulta esatta.

Codice IUPAC, sovrapposizione di sequenze;
Dal menù 'Sequence Utility' , visto prima, selezionare 'Join Sequence in IUPAC format'. Questa applicazione è in grado di unire, sovrapponendole, due o più sequenze nucleotidiche. La sequenza finale sarà scrittà con i caratteri canonici delle basi e con gli appropriati codici IUPAC se le basi sovrapposte risultano differenti.

Scrivere, nell'apposita form, in formato FASTA, due o più sequenze. Fate in modo che le sequenze immesse, differiscano solo per poche basi (due o tre), poi lanciare la query e commentare i risultati ottenuti.
Suggeriamo ACCTGACGCATGCGCATGCGCAA e ACCAGGCGCATGAGCATCCGCAA
Alla fine, osservare e commentare i codici non canonici contenuti nella sequenza complementare (riportata nei risultati) confrontandoli con quelli presenti nella sequenza ottenuta.


FINE ESERCITAZIONE IN LABORATORIO


Provate a svolgere questa parte sottostante da soli, a casa. E' un buon esercizio che serve per ripassare argomenti svolti durante le lezioni. Se avrete dei problemi, potremmo discuterli a lezione, oppure nelle apposite ore di esercitazione in aula.

Confronto tra record NCBI ed EMBL

Due sistemi di ricerca in banche dati nucleotidiche spesso utilizzati sono SRS di EBI ed Entrez dell'NCBI. Nel caso di EBI per cercare un record si inserisce una query nella maschera "Quick Text Search", mantenendo selezionato "nucleotide" come tipo di query. Una volta visualizzato l'elenco di record, si clicca su quello di interesse. E' utile visualizzare il record come Text Entry, non come EmblEntry (dal link in alto a sinistra). 
Vi proponiamo di controllare la struttura dei record in queste due banche dati, per capire le informazioni che è possibile ottenere. 

 - Cosa significa CDS? Che utilità ha?
 - E' possibile avere più CDS in un unico record? Perché?
 

Taxonomy Browser

Questo database contiene il nome di tutti gli organismi rappresentati nei database genetici dei quali sia stata depositata almeno una sequenza nucletodica o proteica. Grazie ad esso, si può anche risalire alla struttura tassonomica o recuperare i dati di sequenza per un particolare gruppo di organismi, o molto più semplicemente risalire al nome scientifico di un organismo di nostro interesse.

Provate ad esempio a risalire al nome scientifico del pomodoro (tomato) e della vite (wine grape).
  Quali sono?

2CAN, un sito introduttivo

Questo sito fornisce delle informazioni brevi e concise, ma comunque rigorose, su concetti chiave della Biologia cellulare e molecolare ed anche della Bioinformatica, con lo scopo principale di renderle comprensibili a tutti .
  Ad esempio, con il glossario, messo qui a disposizione, provate a risalire alla definizione di gene.